MgSTS46

Genetic marker
Map(s): Not Mapped
Forward primer: AGTGCTGCAGCTCAATGCTA
Reverse primer: GCTGGATCGATTCTGAGGAC
Tm: 0.0
Physical marker
Overgo sequence fw: GGCAACACTATCTGTTACAACAGG
                ||||||||
Overgo sequence rv:                 TGTTGTCCCGAACGACGAGGAAAG
Tm: 65.4
Set: A
Pools: 1,6,11
View Map
Sequence
Unigene: MgU212 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-98 bp
ATGACGAGTGCTGCAGCTCAATGCTATAAGGCAACACTATCTGTTACAACAGGGCTTG
CTGCTCCTTTC
AATAATTTAGCTATAATATACAAACAACAG

>Exon-2 99-301 bp
GGGTAATTATGGAGACGCAATATCTTGCTATAATGAGGTCCTCAGAATCGATCCAGCAG
CAGTTGATGGCCTTGTGAACCGGGGTAATACTTACAAAGAAATTGGGCGAGTTAATGAAG
CAATTCAAGACTATCAGCATGCTATTGCCATCCGGCCAACCATGGCTGAGGCTCATGCTA
ATTTGGCTTCTGCTTACAAGGACAG

>Exon-3 302-398 bp
GTGGTCGTGTGGAAGCTGCGATTAAAAGCTATAAGCAAGCATTGACATTGCGTCCAGATTT
TCCAGAGGCAACTTGTAACCTTCTTCACACCTTGCAG

>Exon-4 399-470 bp
GTGTGTCTGCGACTGGGATGATCGAGACAAGATGTTTATTGAAGTCGAAGCGATACTTAGG
AGACAGATTAAG

>Exon-5 471-547 bp
GATGTCAGTGATTCCAAGTGTGCAACCCTTCCATGCAATAGCTTATCCTCTTGACCCCATG
CTTGCACTAGAGATCAG

>Exon-6 548-667 bp
GTTGGAAATATGCTGCACACTGTTCAGTTGTAGCATCCCGTTATTCACTTCcACCTTTTAC
CCATCCTCCACTCTtaccTgtaaggggtggTggCagaaataGccggttaagaatcggt



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: