MgSTS45

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 30.20cM
M. guttatus Irn Mtn Combined(2009)13 99.33cM
M. guttatus IM62_x_DUN RILs(2009)13 7.08cM

Forward primer: CTGCTGCTGCATCGAATAAA
Reverse primer: GTCCAAATCCATCGATCCAC
Tm: 0.0
Physical marker
Overgo sequence fw: CAGCGTGCCGCTTCGTATATCTCT
                ||||||||
Overgo sequence rv:                 TATAGAGAGTTAGAGGAGGAGTTA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1066
MG__Bb017O16
MG__Ba050E20
MgFPC2651
MG__Bb025C03
MgFPC2723
MG__Ba088N17
MgFPC2724
MG__Bb065K12
MG__Ba054G01
MG__Ba074N07
MG__Bb091N05
MlFPC81
ML__Ba088L24
ML__Ba051H15
ML__Ba082D17
Set: A
Pools: 1,10,15
View Map
Sequence
Unigene: MgU176 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 158-230 bp
CGAAAAGCCCATCGAAAATGTTGAGAGCTTTCAGCGTGCCGCTTCGTATATCTCTCAATC
TCCTCCTCAAT
ATA

>Exon-2 231-353 bp
ATATTGTGCACGAAACAAGATCCTCCGTTCGCTAGTGGATAAATCGACAGCTAGCTGTTTC
AAGAACAGTTTCCGGTTCAAAAGCTTCGGATTTGTCACGTCCAAATCCATCGATCCAC
TCGCC

>Exon-3 354-485 bp
CTGAAGAAACTTGGAGTACTTCGATATGCTGACTTCACAAGTATCCAGAATAAATTGCAAC
GCATCTTCTTCTAGTTCAGGATATCGAACATCCCTTTTCGACGTATTTTTATTCGATGC
AGCAGCAG
CCATC

>Exon-4 486-588 bp
CTCGTCAAACTGGTTTACCATACTCGGTGGGCTTACTGCCAAGTAAGCATATGCCATCAAC
TCGACTGGCCAACCAGTTATTTGCAGAGGATAACATTGCGACG

>Exon-5 589-721 bp
GCanaTAGTCCGTGTTTCTTCAAAGCTTCGGATTTTTCTTTGTAACAATCGTCGTATTTTA
GAAGTGAGAGTGATATCTCAACGGAGTCACGAGGATTAgTgccttCACgtggaacanaTc
CGTACgaAAGCAA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: