MgSTS44

Genetic marker
Map(s): Not Mapped
Forward primer: CGATTTTGATCGAAGGGAAA
Reverse primer: CCAAGATTGCGGTCTTGACT
Tm: 0.0
Physical marker
Overgo sequence fw: GAAGGCAGCATCATAGTAACCCCT
                ||||||||
Overgo sequence rv:                 ATTGGGGAAGGCTAAACACGTTCG
Tm: 65.4
Set: D
Pools: 1,9,15
View Map
Sequence
Unigene: MgU146 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 -1-94 bp
TA

>Exon-2 95-172 bp
CTATATCGAAGGCAGCATCATAGTAACCCCTTCCGATTTGTGCAAGCATTTGCAAGAAG
TAATGGTTGCAGTATAAACC

>Exon-3 173-329 bp
CTATCCCAAACGTGCAGATCCGAGGAGAAGTCAACCCTCCCTTCACAAGTTGAGTTCTCAT
TGAATCACAAATGCCCTTTTCATCTTCAACTGATCCATCGGTTATAAGAAAAATTACGGG
AAGTAAATCGCCGGTTTTTGAGAACATTTTTATAGCC

>Exon-4 330-602 bp
CTGGTTTAAAGGAGCTGAGATGTTTGTGCCGCCCTTGGCTATAAAATTAACCTCAATCCAT
TCAGAAGCTTCTTTTATCGTCTCCTTATTCGCCGGAACCAAATTAGACGAAGAAAATAAC
GAAGTTTTTTCATTGAATGCTATAACATTGAAAGTATCTGTCGGATTGAGATTTAATAAA
GAAGCCAAGATTGCGGTCTTGACTTTCTCAAGTTGACTTCCTTGCATGCTGGCGCTTA
CGTCGACTATATATACCACTTCTTTTCTAAAAACC

>Exon-5 603-722 bp
CTTAGTACTAATTGACCTttTcccTgngtatagataacagncaaacatttcccttcgatc
aaaatcg
ttcgtagatggagattgcaataataaaccgccaacaatttcactcgaacaaa
ca

>Exon-6 723-812 bp
attgtatgaanaacTGaaGTCGttcACGGACCACATcggaacttctCTCTCgcaaCGaAAT
CCGATTTTGGTATCTTCCTCTCCGATTCTC

>Exon-7 813-1025 bp
CTTTAGAGGATGACTAGTGCTCCGAAACGAGAATTCTGTTCcggcaACggAAttAACGTTA
ACTGAAATCTTTTCGTTTTTAACAAAGTTTTTCGACACGGGATTAACATACGAAGGAAAA
GTGAAAGGTACATTGAGGCGAAATTGTCCGTCTTGATATAATAATTTCTGGGACCAACTA
ACTTTAACAGTCAACATGGTTCCACCACTAACC

>Exon-8 1026-1178 bp
CTTGGGAATTTTGAGTGTGTATATTTGGCCTTTAATCAAGAATCCATCTTTACTGCTCTCT
ACTTTGGCTGCATCTGCAGTTTCTTGCAGTGAGATCAATTGTGTACTGTAGGATTTTGAA
GGGGTTTCGATTTCTACACCTAGAACTGAACCC

>Exon-9 1179-1403 bp
CTGTTCACCAATCGNGCACAGCAATGCGGCAGTAGCAGCTCCTACTCGCGGAGACGCAGTG
TACCCTCCACGCGCCGCCGACTGTAACAAAAGCCGTATCCAGACAACAGTCGACCTCCAC
CGAAACCCCATGCATGTGCAGCGGAATCAGCGCCGGCGTCTCGCACCTGCCGTGAACGTA
CGGCTGGTAGCTCGGTACGTCGGGATTATCCACCACCGCCGGATC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: