MgSTS43

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 47.50cM
M. guttatus Irn Mtn Combined(2009)10 37.88cM
M. guttatus IM62_x_DUN RILs(2009)10 56.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 71.58cM

Forward primer: CCGGGAAACGATAGAACAAA
Reverse primer: CAAGGGAGTTCCCTGCAATA
Tm: 0.0
Physical marker
Overgo sequence fw: GCCGATGGAGAGTGGCTTACTTCT
                ||||||||
Overgo sequence rv:                 AATGAAGAAGAAGACCGTTTAGAC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC817
MG__Bb094C20
MG__Bb005K03
MG__Bb081B02
Set: A
Pools: 1,10,14
View Map
Sequence
Unigene: MgU123 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 112-255 bp
ATGGCGGGGAGTGGAGTTTTTAGTGAGATAATCGATGGTGAAGTGTTCAAATACTACGCC
GATGGAGAGTGGCTTACTTCTTCTTCTGGCAAATCTG
TTTCCATTGTTAATCCCACTAC
AAGAAAGACACACTACAAAGTTCAAG

>Exon-2 256-449 bp
GCTTGTACGCAAGAAGAGGTGAACAAGGCGATGGAAATAGCGAAAGCAGCACAAAAGTCGT
GGGCGCGGACCCCACTTTGGAAGCGGGCCGAGCTTCTTCACAAGGCTGCAGCTATCCTTA
AAGAGCACAAAGCCCCTATTGCAGAGGCTTTAATTAAGGAAATCGCAAAGCCAGCCAAAG
ATGCCGTCACCGAG

>Exon-3 450-578 bp
GGTTGTTAGATCCGGCGATTTGATCTCTTATTGTGCCGAAGAGGGCGTTAGAATTTTGGGA
CAGGGCGCATTTTTGGTGTCCGATAGTTTTCCGGGAAACGATAGAACAAAGTACTGTC
TCACATCCAAG

>Exon-4 579-698 bp
GATTCCGCTCGGTGttATTTTGGCTATACCACCTTTTAATTATCCCGTanacCTTGCTGTA
TCCAAAATCGGACCGGCTCTTAttgCAGGGAACTCCCTTGTTCTCAAGCctccaactc
ag

>Exon-5 699-712 bp
gggtgcggtggctt



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: