MgSTS42

Genetic marker
Map(s): Not Mapped
Forward primer: AGGCCACTTCATCCAGTCAC
Reverse primer: CTTCCGAAGAACACGACCAT
Tm: 0.0
Physical marker
Overgo sequence fw: GGGGGCCATGCTAAAACTGTTACT
                ||||||||
Overgo sequence rv:                 GACAATGACAACTACCGTGAAGAG
Tm: 65.4
Set: D
Pools: 1,9,14
View Map
Sequence
Unigene: MgU0 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 64-236 bp
ATGAGAGTGGCGGTGGTGGGGGGCGGCGTAAGTGGGCTGGTCTCCGCCTATGTGGTGGCGA
AAGGCGGAGTGGAGGTGGTGGTGTACGAGAAGGAAGATTACTTGGGGGGCCATGCTAAA
ACTGTTACTGTTGATGGCACTTCTC
TAGACCTTGGTTTTATGGTCTTTAATCGA

>Exon-2 237-560 bp
AGTTACATATCCAAACATGATGGAATTCTTCGAAACCCTCGGAGTCGAAATGGAAATATCC
GACATGTCATTCTCGGTGAGCTTAGACAAAGGCCAAGGATGCGAATGGGGTAGCCGTACC
GGTTTTTCGGGATTGTTTGCACAAAAAAAGAATGCAATTAATCCTTATTTTTGGAAAATG
ATcaaAGAAATCCTCAAATTTAAGGATGATGTCATTAATTACGTTGAAGAGCTCGACAAC
AATCCGGATTTCGATCGAAACGAAACACTAgGCCACTTCATCCAGTCACGTGGCTAtT
CCGAGTTATTCCAAAAGGCCTATCTT

>Exon-3 561-662 bp
TATACCGATTTGCGGttCGATATGGTCGTGTTCTTCGGAAGGAGTAATGAGTTTCTCTG
CGTATTCCATACTTTCgttntgtcgtaatcaccaccttttgcag

>Exon-4 663-694 bp
gctctttggtcgtccacaatggcttaccgtga



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: