MgSTS41

Genetic marker
Map(s): Not Mapped
Forward primer: GGTAGCGGAATTCATCCTCA
Reverse primer: GCAGAGCTTTCACCACCTTC
Tm: 0.0
Physical marker
Overgo sequence fw: CGGAATTCATCCTCAGCCATAGCT
                ||||||||
Overgo sequence rv:                 GGTATCGAAGTGGTCTCATCGAGA
Tm: 65.4
Set: D
Pools: 1,9,13
View Map
Sequence
Unigene: MgU723 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 164-243 bp
ATGGATTTGGAAATTAATTACGAAATTGCGCGGGTAGCGGAATTCATCCTCAGCCATA
GCTTCACCAGAGTAGCTCT
ACAG

>Exon-2 244-431 bp
GTTCCCAGATGAGCTACTGAAAGATTCTATGAAGGTGGTGAAAGCTCTGCGCAAAGAGA
TAAATTCGTCTGCTGTGAAGCTGTATGTAATGGCTGACACAACTTATGGAAGCTGCTGTG
TCGATGAAGTCGGGGCGGCTCACGTAAATGCCGAATGTGTCGTTCATTACGGCCATACTT
GCCTCAGCCC

>Exon-3 432-540 bp
CGACATCGAAGCTACCTGCACTGTTCATATTCGAAAAGGCTTCAATTAGCACATCGAATTG
TGCATTGAAATTGCTCGATTACGGGATGACAAGCGACAAGCCAATTTTG

>Exon-4 541-605 bp
GGTTNTTTTTGGACTGGAATATGCACATGCAATACCAGAAATTAAGAAAAATTTAGCATCT
AGCGT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: