MgSTS40

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)5 16.40cM
M. guttatus Irn Mtn Combined(2009)5 15.24cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 106.08cM

Forward primer: GGGCAGCTTGTACTGGAAAA
Reverse primer: GGGTAGCGGTGAAGGATGTA
Tm: 0.0
Physical marker
Overgo sequence fw: AGAATAGCATCACCACTCGCTCCA
                ||||||||
Overgo sequence rv:                 AGCGAGGTTAGGGTGAGGTTTAGG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC102
MG__Bb032G19
MG__Bb070D11
MG__Bb083B06
MG__Bb035M06
MgFPC1152
MG__Bb064K04
MgFPC159
MG__Ba070H07
MgFPC313
MG__Ba087M24
MlFPC1438
ML__Ba028P22
ML__Ba056F14
ML__Ba095O03
ML__Ba032M22
ML__Ba047I05
ML__Ba006O12
ML__Ba047D22
MlFPC169
ML__Ba048E19
MlFPC258
ML__Ba063E09
MlFPC454
ML__Ba021J22
MlFPC486
ML__Ba080H01
Set: A
Pools: 1,10,13
View Map
Sequence
Unigene: MgU633 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 122-249 bp
ATCATGGAGTTATTCTCTGAGGGTCGCGAGGGAAGAGCGATGTTTTGCGGATATTGTTGAG
TGCACAGAATAGCATCACCACTCGCTCCAATCCCACTCCAAATCCGCCATGTGGCGGT
GCCCCGTACC

>Exon-2 250-364 bp
CTGAAAGAATCGATATATGTCGAGATTGTGTTAACATCAATTCCGCATGCTTGAGCACGCT
CTGTCAAGAACTCAGGCACATGCACACGTTGAGCTCCTGATATGATTTCCTCGCC

>Exon-3 365-480 bp
CTCGTATAAAAACATCAAACGAGTTGCTATACTTCATGTCATCATGACACGGCATGGTATA
GAACGGTCGAACTCCGAGAGGGTAGCGGTGAAGGATGTAGAATTCGGTTCCATACT

>Exon-4 481-560 bp
TTTTCCAGTACAAGCTGCCC
GAGCTTTCTTTCGGATTCTGTGTTGAGATCTCCGAGTGGG
TCAACGTCAACACCAGATTCC

>Exon-5 561-614 bp
CTTGAGCATTTGTACGCCCTCTTCGAATGTAAGACGCANAGTTTGGCGCANATAC

>Exon-6 615-725 bp
CTTAAGCGGCTCANAGGGGTACTGCTTGTTGATTGCTTCGAGCTCCTTGGAACATGTCTCA
TTCAAACCGTCAAACATCGTGACAAATAAACGGTCAACAATGTCCATAACC

>Exon-7 726-739 bp
CTCTGAATAATGCTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: