MgSTS4

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 0.00cM

Forward primer: CGGTTTGGAGACTTCTCAGC
Reverse primer: ACTCAAATGTGGCCTTCCAG
Tm: 0.0
Physical marker
Overgo sequence fw: CTTGACGAAAAGCCCTTGCAAAGG
                ||||||||
Overgo sequence rv:                 ACGTTTCCGGAACTTCCAACGAAG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1709
MG__Bb061D20
MgFPC174
MG__Bb090I04
Set: D
Pools: 1,6,13
View Map
Sequence
Unigene: MgU881 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 165-193 bp
ATCAAGTTCGTGACAGGACGCCTTTCGAGC

>Exon-2 194-303 bp
CTAGGCACACTTCCACGACGACNAGGATCGTATTCGGTGGCTTGACGAAAAGCCCTTGCA
AAGGCCTTGAAGGTTGCTTC
TATAATGTGGTGCGAGTTTTTCCCAGCAAGC

>Exon-3 304-366 bp
CTGTCGTATGTGTAGTGTCATTCCAGAAGTATTGACCACGGACTGAAAGAAGTGCTCCACC
AGC

>Exon-4 367-441 bp
CTGTGTATCGTAAGTTCCAACTCTCTCGGTCGGTATGTTCAAATCATAACTCAAATGTGG
CCTTCCAG
ATAAATCC

>Exon-5 442-534 bp
CAGTGAAACATGTACAAGTGCTTCATCGAGAGGAGCTGAGAAGTCTCCAAACCGGTTGA
TTCCTTTCCTATCACCAAGTGCTTGCAACAAAGCG

>Exon-6 535-638 bp
GGTCCCAATAGCTAAGGCAACATCTTCATTTGTGTGATGATCGTCAATATGAATATCCCCC
GTTGCCTTCACATGCATGTCAAATAGTCCATGTGAAGCAAGTTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: