MgSTS39

Genetic marker
Map(s): Not Mapped
Forward primer: CTCGGAAGACACTACCAGCA
Reverse primer: TCGGAAGGATCTCCACAAAC
Tm: 0.0
Physical marker
Overgo sequence fw: GAGCGTTTCCCGTGATTATCTCAA
                ||||||||
Overgo sequence rv:                 ATAGAGTTCCTGATGTCGTGAAGG
Tm: 65.4
Set: B / C
Pools: 1,6,12 / 4,10,15
View Map
Sequence
Unigene: MgU628 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 37-191 bp
ATGGAAGACATAGAGGACTTATTGGTCGGGGGAGGCGGCGGAGCGCCGCCGGGATTTCGGA
TTCCGGTCGCAGCCGCCGTCGGTATCAAGCCAAAGAAGAGCGTTTCCCGTGATTATCTC
AAGGACTACAGCACTTCC
AAAATACCTGGCACTCAG

>Exon-2 192-230 bp
GACAATCTACATAAAGACTTTTGGGTGTTCACATAATCAG

>Exon-3 231-322 bp
GAGTGATAGCGAATACATGGCAGGGCAACTTTCTGCATTTGGATACAATTTGAGTGAAAAC
CAGGATGAAGCAGACCTATGGTTGATAAACAC

>Exon-4 323-572 bp
CCTGTACAGTTAAGTCCCCTAGTCAGTCTGCTATGGATACACTTATTACTAAATGTCGAAA
TGCAAAAAAGCCTCTAGTGGTTGCCGGATGTGTTCCTCAGGGAAGTCGTGATCTGAAAGA
GCTCGATGGAGTAAGTATAGTTGGAGTCCAGCAAATTGATAGAGTGGTAGAAGTCGTCGA
AGAAACCCTAAAAGGTCACGAGGTTCGACTCCTGACTCGGAAGACACTACCAGCACTT
GATCTTCCAAAG

>Exon-5 573-679 bp
GGTGAGAAAGAACATGTTTGTGGAGATCCTTCCGATTAACGTTTGTTGCTTAGGTGCTT
GCCCTTATTGCAAGACAAAGCATGCTCGTGGTCATCTTGGGAGCTACAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: