MgSTS38

Genetic marker
Map(s): Not Mapped
Forward primer: ATGAGCATGGCATCGACATA
Reverse primer: GTCTCACCGTGTCGGATTTT
Tm: 0.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU1179 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 188-269 bp
CTTAGAGACCGTCGAAGAATCTTAAATGGTCGTCAAATGTCTCACCGTGTCGGATTTTG
GACAAAGATCCATCATCTTCAACC

>Exon-2 270-359 bp
CCAGTATTCAGGGGGGCGCATCTTGAGATTGTATGTCGATGCCATGCTCATGCAGTAAG
CACCGGCATCGTGAACTACCAATCCAGCACCC

>Exon-3 360-482 bp
CTTAGTAGGTGTGGGTAATTCCCTGTCTTTCCCTAGGAAATCTGCAGATTCACAAACGGGA
CCCACCACATCGAAAGTCGAAATCTCGGCATCTGATGGTGAAGGTGAAACCAGCTCTATG
TGC

>Exon-4 483-648 bp
CTGGTAAGCCCCATATAAACTCGGGCGAATAAGTTCCGACATGCTACCATCAATCACAATG
AAATTCTTCGTCCCGTTGGTTTTCACTCCAGTCACATGATTGACAAAACAGCAAGTGTTT
GCAATGAGTGATCTTCCAGNGTCAATACTAGATTGAGATTTCGTGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: