MgSTS37

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 79.30cM
M. guttatus Irn Mtn Combined(2009)10 97.95cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 104.32cM

Forward primer: TGGTGTTCAGGGTGCTGTAA
Reverse primer: CCGATGCTATGATCCCTGTT
Tm: 0.0
Physical marker
Overgo sequence fw: CAGGGAGAGGATCAGAAGAAGCTT
                ||||||||
Overgo sequence rv:                 TCTTCGAACTACAACAGAGGTTGC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC42
MG__Bb094J10
MG__Bb086O21
MG__Bb077O11
MG__Bb074H22
MG__Bb027I15
MG__Ba020N06
MG__Ba021M05
MG__Bb072C03
MG__Bb060P18
MG__Bb065N23
MG__Bb038K09
MG__Bb025M02
MG__Bb028I17
MG__Bb025C18
MlFPC1049
ML__Ba019C22
MlFPC1626
ML__Ba080O20
ML__Ba028G12
ML__Ba047D05
MlFPC1784
ML__Ba024D04
MlFPC730
ML__Ba070G22
Set: A
Pools: 1,10,12
View Map
Sequence
Unigene: MgU1047 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 2-435 bp
ATGGTAGCTGCTTCAGCCACAACGCCGGCGTCTCATCTTCTCTTCTCCAGCTCCCAAGCCA
TCTCCCGTTTCACCCCTTTCCACACGCTATCCTCCTCATGCCCCACCGCCGCCGCAATCA
GCGGCGCCGCCGCCAGGCGGAGGAACTCGGCCGCCGGAGGCGGAGGAGTGCGGTGCATGG
CCGTGGCGGAGGGGGCGGCGACGAGGAAGAGGAGCGGGTACGAGATTCAGACACTGACTA
ACTGGCTGCTGAAGCAAGAACAGGCGGGAACCATCGACGCAGAGCTTACCATAGTTCTTT
CGAGTATTTCAATGGCGTGCAAACAGATTGGCTCACTTGTTCAGAGGGCTGGCATTTCTA
ACCTAACTGGTGTTCAGGGTGCTGTAAATATACAGGGAGAGGATCAGAAGAAGCTTG
ATGTTGTCTCCAACG
AG

>Exon-2 436-644 bp
GGTTTTCTCTAATTGCCTGAGGTCGAGTGGAAGAACAGGGATCATAGCATCGGAGGAGG
AGGATGTTCCAGTGGCGGTGGAAGAAAGTTACTCCGGCAACTACATTGTCGTTTTCGACC
CTCTCGATGGATCATCCAACATTGATGCAGCTGTCTCAACCGACTCCATTNTCGGCATAT
ACAGCCCTAATGACGAATGCTTAGCCGACAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: