MgSTS36

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)12 110.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 48.47cM

Forward primer: TGTGGATGAGAAGGACGTTG
Reverse primer: GGCTTGCGCTTTGTATCTTT
Tm: 0.0
Physical marker
Overgo sequence fw: GTTAAACGGGTACTCGAAGAACAG
                ||||||||
Overgo sequence rv:                 TTCTTGTCATACCACCACTCCTTC
Tm: 64.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1475
MG__Ba085K15
MG__Ba090M01
MG__Ba086G02
MG__Ba054B11
MgFPC2960
MG__Bb082A20
MG__Bb088H22
MG__Bb002M13
MgFPC366
MG__Ba086F13
MG__Ba054L10
MG__Ba060A08
MG__Bb018E21
MG__Ba094P01
MG__Ba024H01
MG__Ba031C08
MG__Ba021L03
MlFPC1188
ML__Ba064N09
MlFPC145
ML__Ba014J20
MlFPC1877
ML__Ba014P01
MlFPC289
ML__Ba088E11
ML__Ba044G24
ML__Ba096G13
ML__Ba089F20
MlFPC371
ML__Ba058E11
MlFPC907
ML__Ba068B07
Set: A / 3x3x3
Pools: 1,10,11 / 1,7,11
View Map
Sequence
Unigene: MgU1001 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-41 bp
GTTAAACGGGTACTCGAAGAACAGTATGGTGGTGAGGAAGAG

>Exon-2 42-188 bp
GCTGCCACAGACAAATCCTGGCTACAACAACACTCCATTCAAATTTACAAAATACTCAAAT
GCATACATGCTGGTGTATATTCGAGTGAGTGACAAGGATAAAATTATTTGTGATGTGGA
TGAGAAGGACGTTG
CAGAACATCTTAGG

>Exon-3 189-269 bp
GATACGGCTGAAAAAGGAACAAGAAGTAAAGGAAGATAAGAAAAGATACAAAGCGCAAGC
C
CACCTTTACACTATTATCAAG

>Exon-4 270-389 bp
GGTTGCCCGAGATGAAGACTTGAAGGAACAAATTGGAAAGGATATTCATTTCGATCTTGTT
GATCATGATAAAGTCCATAACTTCAGAATCCAGAAACAGACACCTTTTAACCTTTTCAAG


>Exon-5 390-512 bp
GGAGGAGGTTGCTAAAGAATTTGGTATACCAGTTCAATTTCAGCGCTTCTGGATATGGGCA
AGAAGACAGAACCATACATTTCGTCCAAACAGGCCATTGACACCACAGGAGGAAGCACAA
ACT

>Exon-6 513-590 bp
TGTTGGAGCATTGAGGGAAGTTTCCAATAAGGCCCACCATAATGCAGAGCTGAAGTTGTTC
TTGGAAGTAGAGCATGGA

>Exon-7 591-651 bp
ACCGGATTTAAATATGCTTCCTCCNCCAGAAAAAATAAGGAAGACATACTCCTGTTCTTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: