MgSTS35

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 18.70cM
M. guttatus Irn Mtn Combined(2009)9 67.41cM

Forward primer: AAAATCGGGGAGAATTTTGG
Reverse primer: CACACGTGGCTGGATTACAC
Tm: 0.0
Physical marker
Overgo sequence fw: GTGAGGAGTGTGCGGAAACATGTC
                ||||||||
Overgo sequence rv:                 TTGTACAGGTGACCAACTTACGAA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2160
MG__Ba048B11
MgFPC400
MG__Bb096O19
MG__Bb040D16
MG__Bb011J10
MlFPC107
ML__Ba096A18
ML__Ba083L03
ML__Ba012K22
ML__Ba001E09
ML__Ba004E07
MlFPC1653
ML__Ba001P02
ML__Ba090N24
Set: A
Pools: 1,9,15
View Map
Sequence
Unigene: MgU977 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 164-272 bp
TTATACTTAGCTCCAACAGGCACACGCATTCAATGTGAGGAGTGTGCGGAAACATGTCCA
CTGGTTGAATGCTT
TTCAGTTTGTAACATCCTTCAATTTTCTGCTCAGCC

>Exon-2 273-403 bp
CACACCATGACAAAGGTAATCGAGGTCACGAGCACACGTGGCTGGATTACACGACACAT
AGATAATTCGTTCCGCTTTTAATTTCAGCAAAAACTTGATTAACTTCATGTGCATGCCAG
GCCGATTAGGATC

>Exon-3 404-570 bp
CTGTGATGACAAGATCTGGCTTGGGGAAATATTCTCCAAAATTCTCCCCGATTTTATTA
AGGTCCCCTTGGACAAATGTGGCGTTGGATATGCCATTAATATCCGCGTTACGACGTGCA
TCTGATATGGCTTGATCGACTATCTCANAACCATACACATGTTTTGCCC

>Exon-4 571-686 bp
CTTTTTGCAAGTGTTAACCCGATTGTCCCAGTCCCACAAAAGAGATCTAGAACTATTTCTG
ATCCGTCTCCTTTCAGAAAAGAGCTTTCCTCTATTAGTTTATACAGAATCTCTGCC

>Exon-5 687-723 bp
CTGGTGTGTGTTCGTCTGAAGAAAGAGTTGGCTGAAAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: