MgSTS34

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)7 31.30cM
M. guttatus Irn Mtn Combined(2009)7 21.47cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 16.68cM

Forward primer: ACGAACGAGCAAATCGAAAT
Reverse primer: CTCCTGGACGACAATGACCT
Tm: 0.0
Physical marker
Overgo sequence fw: TTCTGTAATGACACCTCAGCAATC
                ||||||||
Overgo sequence rv:                 GTCGTTAGACTCGCGTTTGGGAGG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2685
MG__Bb076P10
MG__Bb074G05
MG__Bb088N05
MG__Bb079F24
MG__Bb054K13
MG__Bb095J10
MgFPC478
MG__Ba007N24
MlFPC172
ML__Ba051K12
MlFPC954
ML__Ba050H23
ML__Ba075N05
Set: A
Pools: 1,9,14
View Map
Sequence
Unigene: MgU963 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 122-225 bp
TCGTTCCCATGTTCAGCACAGGTTTCCAAGAAAATGGTGTCCAAGAAAGTTGTTTCTGTA
ATGACACCTCAGCAATCTGAGCGCAAACCCTCC
GCAACCGGCGCG

>Exon-2 226-396 bp
GGTTAAGACTGGGATGACAATGACTGAGAAGATATTCGCAAGAGCTTCGGAGAAATCCCAA
TTGATACCCGGCGAGAACGTGTGGGTCAACGTCGATATCTTGATGACCCACGATGTTTGT
GGCCCGGGTTCTATCGGGATTTTCAAGAAAGAGTTTGGGAAAAATGCAAAG

>Exon-3 397-549 bp
GGTGTGGGACCGTGAAAAGATTGTAATAATTCCAGACCATTACATCTTCACAGCCGACGA
ACGAGCAAATCGAAAT
GTCGACATCTTGAGGGATTTCTGTAACGAACAAGATATCAAGT
ACTTTTACGACATTAAAGATCTCGGGAATTTTAAG

>Exon-4 550-618 bp
GGCAAATCCAGATTACAAAGGCGTGTGCCACGTGGCGCTTGCTCAAGAAGGTCATTGTCG
TCCAGGAG
AG

>Exon-5 619-734 bp
GGTTTTGTTGGGTACGGACTCGCACACATGTACCGCTGGAGCATTTGGTCAATTTGCTACC
GGGATCGGAATACCGATGCGGGTTTTGGTTTGGGTACCGGAAAGCTTTTGCTTAAG

>Exon-6 735-739 bp
GGTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: