MgSTS31

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 81.67cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 67.73cM

Forward primer: TGGGTTGGAATGTTTTACCA
Reverse primer: CGAAGGCCAAGATTGAGAAG
Tm: 0.0
Physical marker
Overgo sequence fw: CCACTCTCTCGAGTGTGTTCGTTG
                ||||||||
Overgo sequence rv:                 CAAGCAACGTTCGACTAACATCTC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC110
MG__Bb025K14
MG__Bb022A14
MG__Bb080B11
MG__Bb087E17
MG__Bb072L23
MG__Ba090B11
MG__Ba049K23
MG__Bb005H08
MG__Bb032L11
Set: A
Pools: 1,9,13
View Map
Sequence
Unigene: MgU886 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 295-652 bp
CTCAAGCTGCTTTTCCTTGTCGTTTCTCTTCTTCCAACCGAGCCTTGATGAAGGAGTACAT
TGCAACTCCAAATATTGCAATGGAAGTACCGATACCAGTTTGCAACGAGATCTTATTAC
CGAAGGCCAAGATTGAGAAG
CCGATGACAAAGACACGCTTCAACACATTTCCAACAGCA
TGGGTGAGTGGGGCCACTCTCTCGAGTGTGTTCGTTGCAAGCTGATTGTAGAGATGG
TAAAACATTCCAACCCA
GAAAAGATCAGTGATGAACTTTGTTAAGCCCACTTTAGCAAT
TGCATCACTAAACCCATATTTCAATAGTTGAGGCCCTTCAATAATTAAGGCAGGAGGAAT
ACAG

>Exon-2 653-724 bp
GACGATGAGAGCGATAATCGAAATGTAAGCATACAAGTNTGGTGCTGTCCATATCAGTCAT
AGCTTTCTTGGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: