MgSTS30

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 55.70cM

Forward primer: TGGTGTAGGTGACAGCATCG
Reverse primer: TGAGAACACGTTCTGCCTGT
Tm: 0.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU860 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 177-261 bp
CTCAAATCCTTATTCTTTTCCCATCATTTTCCGGAACATTCACATCGCTCGCCCCAAACAG
CGCCTCCGTCTGTCCACGTTCCTGA

>Exon-2 262-314 bp
ATTTTCATTAGGAACAATTGCATATCTCTGAGTGGGAGACACCCAAGTTTTTTC

>Exon-3 315-400 bp
CCGAGGATATGTCAACTTTCGAGGCTGCAATGTTTTGTCCACTTGAACCATCCGTACTTAA
CGCCTCTATAATCTTCGGAACATTTC

>Exon-4 401-519 bp
CGGTCAACACATTCACCATGGCCGAGTTGACCGTTTGTGCCCCTTCCCCATGAGAACACG
TTCTGCCTGT
CGGTGACAGCGAGCGTATGCCTCCAACCACACGAGATGTTGACTACTTT
C

>Exon-5 520-591 bp
CTGATCGAGTGGAAATTTGACTTGCACAGGCGAGCAATGATCGATGCTGTCACCTACACC
A
ACTTGTCCAAAC

>Exon-6 592-663 bp
CTTATTCCAGCCCCAGCCATAGAGTTCTCCGCGGGTCGGTAACGCCATNGTATGCCTCCCA
CCACCTGAAATT

>Exon-7 664-715 bp
TTGAGATATTGACTATCGCGCAAAGATTCCAACCTGCGAGGGACAAAATCGTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: