MgSTS3

Genetic marker
Map(s): Not Mapped
Forward primer: CTTCACTCATGACCGCATGT
Reverse primer: CCGGAGTTCCCTCAAACAAT
Tm: 0.0
Physical marker
Overgo sequence fw: ATTCTCCCGATCAACGACAGCATT
                ||||||||
Overgo sequence rv:                 TGTCGTAATCGCAATGAGAGCTGG
Tm: 65.4
Set: A
Pools: 1,6,13
View Map
Sequence
Unigene: MgU876 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 68-267 bp
GATAAGTGGATTCTCACGGTGACGGCGCAGACGCCGACGAACATAGCGGTGATTAAGTACT
GGGGGAAGAGACACGAGGAACTCATTCTCCCGATCAACGACAGCATTAGCGTTACTCTC
GACC
CCGACCACCTCTGCACCACCACCTCCGTCGCCGTCAGCCCCGCCTTCACTCATG
ACCGCATGT
GGCTCAACGGAAAG

>Exon-2 268-466 bp
GGAGGTATCTCTTTCTGGAGACAGATTCCAGAATTGTTTGAGGGAACTCCGGTCGCGTG
CTAGTGATGTTGAGGATGAGAAGAAGGGTATTAAAATCTCAAAAAAAGACTGGGAGAAGC
TACGTTTGCACATTGTTTCTTTTAACAATTTCCCAACTGCGGCTGGTTTGGCGTCATCAG
CTGCTGGCTTGGCATGCCTGG

>Exon-3 467-530 bp
GTTTTTTCCCTGGCTAATCTAATGAATGTGAAAGAAGATCACAGCAAACTCTCTGCTATTG
CAAG

>Exon-4 531-675 bp
GGCAAGGTTCAGGAAGTGCTTGTCGCAGCTTGTTCGGAGGATTTGCCAAGTGGATCATGGG
AAAAGAGGAAAATGGTAGCGACAGTATTGCCGTTCAACTTGCAGATGAAAAGCACTGGGA
TGACCTTGTTATCATCATTGCAGTG

>Exon-5 676-695 bp
GGGTAGTTCGAGACAGAAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: