MgSTS29

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 106.60cM

Forward primer: TGGGATCTTGTCGTTTGTTG
Reverse primer: ACAGATACCATGGGGTCCAC
Tm: 0.0
Physical marker
Overgo sequence fw: GTCGTTTGTTGATAAGGATCAACT
                ||||||||
Overgo sequence rv:                 CTAGTTGAGCTCGGACCTACACGC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC498
MG__Bb069B19
MgFPC693
MG__Bb076J20
MG__Bb017E08
MG__Bb044I02
MG__Bb078P18
MG__Ba054L01
MlFPC1197
ML__Ba017K06
MlFPC1433
ML__Ba059I18
MlFPC1455
ML__Ba013A14
MlFPC1913
ML__Ba061L21
MlFPC231
ML__Ba022M06
MlFPC322
ML__Ba084F10
ML__Ba049N12
ML__Ba046C04
ML__Ba008H05
ML__Ba094G15
ML__Ba095L18
ML__Ba085D24
ML__Ba093D02
ML__Ba091H24
ML__Ba040O21
ML__Ba053D16
ML__Ba087A07
ML__Ba002G08
ML__Ba083P02
MlFPC542
ML__Ba068L04
MlFPC989
ML__Ba013O21
Set: A / 3x3x3
Pools: 1,9,12 / 1,6,15
View Map
Sequence
Unigene: MgU839 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 68-540 bp
ATGGGTCAAGGTACACCCGGCGGCCTCAATCGGCAACTCCCCGACCGTAAAAACGACGGCG
ATAAGAAGGAGAAGAAATTCGAACCAGCGGCTCCACCGGCTCGCGTCGGCCGCAAGCAGC
GGAAGCAGAAGGGCCCCGATGCGGCGGCTCGGATTCCAACGGTGACGCCTCTGACCAAGT
GCAAGCTTCGATTTTTGAAGCTGGAGCGAATCAAGGACTATCTGTTGATGGAGGAGGAGT
TCGTGGCCAATCAGGAGAGATTGAAGCCCCAGGAGGAGAAGACGGAGGAGGATCGATCCA
AAGTCGATGACTTGCGAGGCTCGCCGATGAGTGTCGGGAACCTCGAAGAGCTGATTGACG
AGAACCACGCGATTGTTTCCTCGTCGGTCGGGCCGGAGTATTACGTTGGGATCTTGTC
GTTTGTTG
ATAAGGATCAACTCGAGCCTGGATGTGCGATTCTTATCCAAANTAAG

>Exon-2 541-678 bp
GGTTCTTTCTGTTGTTGGGCTGCTTCAAGATGATGTGGACCCCATGGTATCTGTGATGA
AGGTGGGAGAAGGCTCCGTTGGAGTCCTATGCTGATATAGGTGGTCTCGATGCTCAGATC
CAGGAGATCAAGGAGGCCGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: