MgSTS28

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 107.60cM
M. guttatus Irn Mtn Combined(2009)6 56.29cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 14.29cM

Forward primer: CGATTGTTGATGCAATCAGG
Reverse primer: GCACGGCATACTGAAGACAA
Tm: 0.0
Physical marker
Overgo sequence fw: GGAAGCATTGTATCTCCCGGAAGA
                ||||||||
Overgo sequence rv:                 GGCCTTCTAGTGTGTGTCGCTATG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2051
MG__Ba057K14
MlFPC149
ML__Ba007O24
MlFPC1534
ML__Ba056G07
Set: A / 3x3x3
Pools: 1,9,11 / 1,6,14
View Map
Sequence
Unigene: MgU836 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 257-311 bp
TTTACATTTCTCCTGGAAGCATTGTATCTCCCGGAAGATCACACACAGCGATACCC

>Exon-2 312-365 bp
CTCTCCAGTGAGATGGGCTACACATTTCTTCTCAGCAAGTAGCTCTGCTTCTGTC

>Exon-3 366-434 bp
CTTCTTGATTCGATTCCAAAGGTAGTCGTCAAACACTACATCCTTGACAAGTTCATAATCA
CCATCTCCT

>Exon-4 435-503 bp
TTTAGATCTGCACGGCATACTGAAGACAATGTCATCTGATATACCGTATGGATTTCCAG
CCGTATATACT

>Exon-5 504-626 bp
TCCGGTTGAAAACCAATCTCCGTCGGGTGTCGGATTCACGAGTGACCTGATTGCATCAAC
AATCG
AGACAGCAGTCGATGCGGCAGAGGATCGTCCCCATTTCTTAATAAGGACGCCAC
CTCTC

>Exon-6 627-652 bp
CGTCTGAACTTTCTCCGTGAACTCCTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: