MgSTS27

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 63.20cM
M. guttatus Irn Mtn Combined(2009)10 54.85cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 87.90cM

Forward primer: GGGAAGGTGTTCGAGATCAA
Reverse primer: TCCTGCAAATCGCACAATTA
Tm: 0.0
Physical marker
Overgo sequence fw: CCACCTGCTAATACAGTGGAAGTG
                ||||||||
Overgo sequence rv:                 ACCTTCACCTTGCGTACCAACGTT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC816
MG__Bb083C19
MG__Ba079B11
MG__Bb074B05
MG__Bb031M03
MG__Bb009L15
MG__Bb008N17
MG__Bb091H24
MG__Ba066M18
MG__Bb092F19
MG__Ba069B13
MlFPC1124
ML__Ba091B21
ML__Ba053I10
MlFPC242
ML__Ba022E02
MlFPC37
ML__Ba062O18
MlFPC50
ML__Ba061C05
MlFPC718
ML__Ba065B24
ML__Ba048C09
ML__Ba076B03
ML__Ba003O13
ML__Ba022O21
ML__Ba056L05
ML__Ba068O18
ML__Ba082C02
ML__Ba043B13
ML__Ba049E17
ML__Ba012A22
ML__Ba002B01
MlFPC971
ML__Ba071B24
Set: A
Pools: 1,8,15
View Map
Sequence
Unigene: MgU374 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 201-239 bp
TCTAGTGACCGTACTTCTGAAACTCCCACTCGCTGTTATC

>Exon-2 240-311 bp
CAAGAGGGCAAACTTGACGAGTCTTAAGCCACCTGCTAATACAGTGGAAGTGGAACGCAT
GGTTGCAA
ACTCC

>Exon-3 312-371 bp
CCCAAGCAACAGTGCATTCCTCGCTGGTGGCACTAGCTTGATTAGCCTGACACTCGATGCA


>Exon-4 372-422 bp
AGAGATCCATGATGTGGTTCCTGCAAATCGCACAATTATCCACCACGATATC

>Exon-5 423-485 bp
CCCAAGCCCAGAGCGAGACGGCGTTCCACTTTTTGATCTCGAACACCTTCCCCTTCTTG
GCGGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: