MgSTS26

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 12.40cM
M. guttatus IM62_x_DUN RILs(2009)11 5.18cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 7.19cM

Forward primer: GATGGAAAGCTCTCGCAACT
Reverse primer: CGCTTAAACATGGGAGCATT
Tm: 0.0
Physical marker
Overgo sequence fw: CCTAGCTTCTAAACGCTTAAACAT
                ||||||||
Overgo sequence rv:                 AATTTGTACCCTCGTAAGAACTCG
Tm: 63.4
Contig BAC
BAC contig and clones containing marker:
MgFPC151
MG__Bb083P22
MgFPC1692
MG__Bb087P16
MG__Ba050O24
MlFPC184
ML__Ba018K14
MlFPC23
ML__Ba076I15
Set: A
Pools: 1,8,14
View Map
Sequence
Unigene: MgU229 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 330-396 bp
ATCACCTCCGAACAGGGGGCACAGCCCCCCTACCAGGTGGAGCACCGCCACGACCAGTAGC
TTGGGCC

>Exon-2 397-453 bp
CCTAGCTCGCATTGCAACCGCACGCCCACGTCCAACACCAAGGGACGAGCCCTTGCCC

>Exon-3 454-520 bp
CTTAATCCTAGCTTCTAAACGCTTAAACATGGGAGCATTCTTGAGCATATCTGGGAT
TACCATGAACC

>Exon-4 521-573 bp
CTGACTTTGCTGCCCCTGATGAAAACATGCTCTAGTTGCGAGAGCTTTCCATCC

>Exon-5 574-731 bp
CTTAGCGGTGTAAGTGATGTTTTCGAGCTGGCAATTCCAGTTATCCTCGCACTCGATCATA
CTTCCCCGATACAGCTCACCGCTCTTCAGCTCCACGGTCACCACGTGTCCCGACGCCTCG
TGCAGCAGCTTCACCGGAATTCCTAAACTCCGACTCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: