MgSTS25

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 18.00cM
M. guttatus Irn Mtn Combined(2009)6 35.22cM
M. guttatus IM62_x_DUN RILs(2009)6 10.08cM

Forward primer: AATGGAGATGTGGGCAAGAT
Reverse primer: AATTGCGGGAACAGCATTAG
Tm: 0.0
Physical marker
Overgo sequence fw: CTTCCCTATCCAGCTCTTCCAACC
                ||||||||
Overgo sequence rv:                 AAGGTTGGGAGGATGAAGAAGTTC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2812
MG__Ba075H23
MG__Ba081P09
MG__Ba075H17
MG__Ba052G20
MgFPC2983
MG__Bb066N07
MG__Bb063B09
MG__Bb071C18
MG__Bb089D12
MG__Ba087M13
MG__Ba028D04
MG__Bb080L23
MgFPC3262
MG__Ba048G11
MG__Bb075O07
MG__Bb087O14
MG__Bb083M18
MG__Bb015C18
MG__Ba033L10
MG__Ba009D02
MG__Ba077P05
MG__Bb004I24
MG__Ba039M24
MG__Ba052F04
MG__Ba023K22
MG__Ba075A20
MG__Ba023G06
MG__Ba081P11
MG__Ba094D11
MgFPC66
MG__Ba002I15
MG__Ba032N07
MlFPC1
ML__Ba069M11
MlFPC10
ML__Ba014C24
MlFPC1880
ML__Ba016A13
MlFPC75
ML__Ba034H10
ML__Ba085D05
ML__Ba009A03
ML__Ba043O22
ML__Ba079C18
ML__Ba007L14
ML__Ba080P05
ML__Ba001E19
ML__Ba044K24
ML__Ba036M04
ML__Ba087M23
ML__Ba050C14
ML__Ba086A22
ML__Ba002K06
ML__Ba051H21
ML__Ba025D04
ML__Ba003M21
ML__Ba047E09
ML__Ba044M20
ML__Ba086D15
ML__Ba012C23
Set: A
Pools: 1,8,13
View Map
Sequence
Unigene: MgU504 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 153-219 bp
TGGACATTTTAATTCTTCTGCTAACTTCCCTATCCAGCTCTTCCAACCCTCCTACTTCTT
CAAG
TTCC

>Exon-2 220-276 bp
CTTAGGTCCTAAAAATAATCCATATGGGACCCCGTTGAACTTCTCCGAGTGATGAAGC

>Exon-3 277-402 bp
CTGATGAGCAGCGGCAACTCTTCTAAAATAGGGTACATTAGCAATGGGCCCCACCGGGAAT
CTCCTGTGGACGAGACCATCGTGGACGAACATATAGGCCATTCCAAAAACCGTTATCCCA
AGGCCA

>Exon-4 403-537 bp
AGCACCAAAACAGAGGCCGGGAATGAGGCCTTTAGTGTAAAAACCGTAGTAGAGGAGGGC
AATTGCGGGAACAGCATTAG
TTATCGCAAAAACATCGTTTAGTTCAAAAGCTCCTTCTC
TTGGTTTATGGTGTGAC

>Exon-5 538-609 bp
CTCGTGCATGTGCCACAACGAGGCGTGCCACAGGGCTTCGTGTGCCCATCTTGCCCACAT
CTCCATT
CCCACG

>Exon-6 610-669 bp
GGCAGCACCGACGGCGAGTAGGAATGTACCAAACATTTCTGCATATGGTATCTCTCCACCC


>Exon-7 670-803 bp
CTCCATTTGCCAAGCAAATCTGTAATAGACAGCTACGATTGCCATGGAAGTGATTCCTAGA
CTCGACATAACGGCCGCAATCAGATAGGTTGACCTCTCCGACTTCTTACGCGCCAATTTC
TCCGCCACCCGCGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: