MgSTS24

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 150.80cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 139.17cM

Forward primer: GGACAAGTTCGTCCAAGTCG
Reverse primer: CCCCTCCCTCCTGAATAACA
Tm: 0.0
Physical marker
Overgo sequence fw: GCACTCGACCTGGTCAAGCATATC
                ||||||||
Overgo sequence rv:                 TCGTATAGGCAAGACTTATACCAC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC523
MG__Ba052C20
MG__Bb080F13
MG__Bb038H09
MgFPC581
MG__Ba056H02
MG__Bb037B05
MG__Bb005L04
MG__Bb059O01
MG__Bb060K11
MlFPC961
ML__Ba058G20
Set: A / 3x3x3
Pools: 1,8,12 / 1,6,13
View Map
Sequence
Unigene: MgU125 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 52-519 bp
ATGAAGGTGATAGAGAAGATCCAGGAGGCGGCGCGTGCGAATGACGATCGGGTGGTGTTCT
CGTTCGAGTTCTTCCCGCCGAAGACGGAGGACGGCGTGGACAACCTGTTCGAGAGGATGG
AGCGGATGGTGGTGCACAACCCTACATTCTGCGACATCACGTGGGGCGCCGGCGGATCCA
CGGCGGATCTGACTCTGGAGATCGCCAACCGCATGCAGAACATGGTGTGCGTCGAGACCA
TGATGCACCTCACCTGCACCAACATGCCCGTCGAGAAGATCGACCACGCCTTGGCCTCCA
TCAAGTCTAACGGCATCCAGAATGTTCTCGCTCTGCGTGGCGACCCGCCTCACGGCCAG
GACAAGTTCGTCCAAGTCG
AGGGAGGGCTCGCTTGCGCACTCGACCTGGTCAAGCATA
TCCGTTCTGAATATGGTG
ACTACTTTGGGATTACTGTTGCTGGTTATCCAG

>Exon-2 520-599 bp
GAGGGACACCCTGATGTTATTCAGGAGGGAGGGGCATCGGCAGAGGCATATCanaGTGA
TCTTGCTTATCTCAaGaaaAAG

>Exon-3 600-721 bp
GGTTGATGCTGGAGCTGATGTGATTGTAACTCAACTCTTCTATGATACTGACATCTtcCTC
anaTtTGTCGATgactgtcgtcnaattggaataacctgtcccattgtgcctggtattatg
c



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: