MgSTS23

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 2.19cM

Forward primer: TGCGTTTAACTTGCCCTCTT
Reverse primer: CTCCATGTCGTTCTCAGCAA
Tm: 0.0
Physical marker
Overgo sequence fw: CCTGTTTGTAAGGTCTCGGAGCTT
                ||||||||
Overgo sequence rv:                 GCCTCGAAACTTCCTAAGTCACGG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1168
MG__Ba039N08
MG__Bb086O20
MG__Ba023B06
MG__Ba022G17
MG__Bb081D15
MgFPC12
MG__Bb014O18
MgFPC1645
MG__Bb021E04
MgFPC183
MG__Bb078G11
MG__Bb043H01
MG__Bb046D14
MG__Bb087M16
MG__Bb091H17
MG__Bb017B18
MG__Ba024C20
MG__Bb005D03
MG__Bb063D14
MG__Bb081A14
MG__Ba009L06
MgFPC227
MG__Bb020O18
MG__Ba019F06
MG__Ba017J08
MG__Bb032E22
Set: B / C
Pools: 1,6,11 / 4,10,14
View Map
Sequence
Unigene: MgU475 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 258-372 bp
TCTAACGGTCATAAGGAAACTCCATGTCGTTCTCAGCAACTTTGAAATGCTGAGGATTT
TGACCAGCACACTGCATATTCCACATCTTGAAGTACGAACGCTCCAGATTCCTCACC

>Exon-2 373-493 bp
CCATCGTGCTGTGTCAAAAAGAGGGCAAGTTAAACGCACAGCCTTCAGCCTGTTTGTA
AGGTCTCGGAGCTTTGAAGGATTCAGTGCC
AAATAAACTGCCTTCTCTTCATACTCTTT
CATAC

>Exon-3 494-640 bp
CTATGCACAATCATCTCTTCCCCAAGTCCCGTAGCCAAACACAAAGAACCAGCAACTCTGG
TAGCCATTTTCTCTAGAGGAAGAGTAACCATAGGTAGACCTGCCCAAAGAATATCTGTTC
CGGTTGTATGTGCATTGCAAAGTGGCG

>Exon-4 641-746 bp
GTATCAAGAAATAGGTTGGCTAATGCACTGCGTCTGATGTGTTCCTGTTTCATTGCAACAT
CCGTGAAAATTATTCGGTCAGGTTGAACACCCCGTGCGGCAGCACG

>Exon-5 747-829 bp
GCGCTCGCAGCCTCATCTCGCCTGCAGCTGGAAATTTGAGAAGCCAAAGGACACTATTTGG
AACACGTTTAAGAATATTGCACC

>Exon-6 830-957 bp
CAAGTTGTAAAAATCTCAGGGTCCATCTTGTAAAGCTGATTGAAACAAGCAAATATAAATT
TGTCCTCGGGTAATCCATAATCCGACCTTCTGTGTTGGCATTTTGGATCCAGTACATCAA
GGTTTTTC

>Exon-7 958-1045 bp
CTGTTTATAGTCATTCACAAAATAGCAATGAGNGTAGATGGACAATCTTTTCAGAGTATAT
ATTTGAGTAGCACATAGGAGAGACAAAC

>Exon-8 1046-1156 bp
CTCATCAGTGACCAAATATTGTATGTAGCTTGCGCCTGTAGTACCGGGAAATCCCATATAA
GAAACCTGAATTGGAGCAGGCTGCATGGCAAATATTTCATTCCTTGCCCCC

>Exon-9 1157-1242 bp
CTTAGTGTAGCCATTAAGGTTGACAAGAATCTGTATCTGGTCCTCATTAATCATCCTTGCA
ATCATATCAGAAGCCATAGCTGACAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: