MgSTS22

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 93.50cM
M. guttatus IM62_x_DUN RILs(2009)6 89.95cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 24.77cM

Forward primer: TGGGTGTTCAACCAAGTGAT
Reverse primer: CCCATGCTTAAACATCATTTCA
Tm: 0.0
Physical marker
Overgo sequence fw: GACTTCATGATCGAGGCCAAGAAC
                ||||||||
Overgo sequence rv:                 GGTTCTTGTCGCATTTCACGAACC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC882
MG__Bb077N14
MG__Ba073L08
MG__Bb012B10
MG__Bb085G22
Set: A
Pools: 1,8,11
View Map
Sequence
Unigene: MgU1122 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 361-398 bp
AGGTGGTTGATTGATGAAGTGAAGGAAAGTTTACCCAAG

>Exon-2 399-618 bp
GGAGTTAGACTTCATGATCGAGGCCAAGAACAGCGTAAAGTGCTTGGATAACTTTAGGA
AGTTCTCTCCACATATTGCAGAATATGTTTATGCTCCTCANATACATTGGAACTTGAGTA
CCTCANAGTTGTTGGTGATGGAATATATTGACGGAGCACAAGTAAATGATTGTAGAGCTA
TTAAGAAGAATGGGTGTTCAACCAAGTGATGTTTCGAAATTG

>Exon-3 619-684 bp
GTTAAGTCAAGCTTTTGCTGAAATGATGTTTAAGCATGGGNTNTGTGCATTGTGACCCG
CATGCTGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: