MgSTS21

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 64.60cM
M. guttatus Irn Mtn Combined(2009)6 38.25cM
M. guttatus IM62_x_DUN RILs(2009)6 63.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 60.45cM

Forward primer: ACTTGTTTTCGCCAAGATGG
Reverse primer: GTTGATGAAGAGGCAGCACA
Tm: 0.0
Physical marker
Overgo sequence fw: CCGTTCTCAACTCCTACGACTATA
                ||||||||
Overgo sequence rv:                 GCTGATATAGTCGGTCCCGGAATT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2601
MG__Ba060C22
MG__Bb080P11
MG__Ba088M05
MG__Ba058J02
MG__Bb069B23
MG__Ba053B10
MG__Bb035J08
MG__Bb011C16
MG__Bb011D06
MG__Bb022B09
MG__Bb066B13
Set: A
Pools: 1,7,15
View Map
Sequence
Unigene: MgU551 (Build 4)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 40-83 bp
ATGGCCGCCGCCGTCTCCACCGCCGCAGCTGTCAACCGCGTCCCG

>Exon-2 84-397 bp
GTTGAACTTGAGTGGATCGGGAGTGGGAGTACCGAGCTCATCGTTCTTGGGCAGCAGCTTG
AAGAAGGTGAACACCCACCAAACCAAATACGCCTCCGGCGGAAGCAGCTTTAAGGTAGTG
GCGGCGATCGAAGACAGCAAGAAACAGACAGACAAGGACAAATGGAAGGGTCTGACCACC
GACATCTCCGACGACCAGCAGGACATCGCCAGAGGTAAGGGCATGGTCGACTCTCTCTTC
CAAGCCCCCACCGGTATGGGTACACACGACGCCGTTCTCAACTCCTACGACTATATCAG
CCAGGGCCTTAA
ACA

>Exon-3 398-503 bp
AATACGACTTCGACAACACGATGAGCGGTTTCTACATCGCCCCTGCTTTCATGGACAAGCT
CATGGTCCACATCTCCAAGAACTTCATGAAGTTGCCCAACATCAAG

>Exon-4 504-589 bp
GGTTCCACTTATCTTGGGTGTGTGGGGAGGAAAAGGACAGGGTAAATCATTCCAGTGTGA
ACTTGTTTTCGCCAAGATGG
GAATTAA

>Exon-5 590-1063 bp
ACCCAATCATGATGAGTGCCGGAGAGCTGGAAAGCGGGAACGCCGGAGAGCCGGCCAAGCT
GATCAGGCAGAGGTACAGAGAGGCGGCCGACATCATCAAGAAGGGGAAGATGTGCTGCC
TCTTCATCAAC
GATCTCGACGCcGGCGCGGGTCGCATGGGCGGGACCACTCAGTACACG
GTCAACAACCAGATGGTCAACGCCACACTCATGAACATCGCCGACGCGCCGACGAACGTG
CAGCTCCCCGGCATGTACAACAAGGAGGAGACCCCCCGCGTGCCGATCATCGTCACCGGT
AACGATTTCTCCACGCTGTACGCTCCCCTCATCCGTGACGGACGTATGGAGAAGTTCTAC
TGGGCCCCCACCCGCGAGGACCGTATCGGTGTCTGCCTCGGNTATCTTCCGCACCGACAA
CATCGCCGACGAGGCCGTCGTCAGACTCGTCGACACCTTCCCCGGCCAATCCATCG

>Exon-6 1064-1454 bp
GATTTCTTCGGTGCATTGAGGGCAAGAGTGTACGACGACGAAGTGAGGAAGTGGATCTCAG
AGATCGGAGTGGACAACATCGGAAAGAAGCTGGTTAACTCGAGGTCGGGCCCACCGAAAT
TCGAGCAGCCAAAGATGACAATCGAGAAGCTTCTAGAATACGGAAACATGCTTGTCCAGG
AGCAAGACAATGTGAAGAGGGTCCAATTGGCCGAGACTTACTTGAAGGACGCCGCTCTCG
GAGATGCTAACAAAGATTCCATTGATAGCGGAGCTTTCTACGGGCAAGCAGCACAGCAAG
TGAATCTTCCTGTGCCTGAAGGCTGCACTGACCCGAATGCAAAGAACTTCGACCCAACTG
CAAGAAGTGACGACGGGACTTGCGTATACCC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: