MgSTS20

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 19.10cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 14.58cM

Forward primer: ACTGGTGCCAAGACGAGAAT
Reverse primer: ATCCCCTCGTAAAAGGCTGT
Tm: 0.0
Physical marker
Overgo sequence fw: GGATGCTCAACATCTGGTACCGCT
                ||||||||
Overgo sequence rv:                 CATGGCGACCCTTATAAGAACGTC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1262
MG__Ba024P05
MG__Bb056I01
MG__Bb071J20
MG__Ba022J19
MgFPC684
MG__Ba091H15
MG__Bb004E09
MG__Ba051C05
MG__Bb092O13
MG__Bb066E14
MG__Bb049B01
MG__Bb092B22
Set: A / 3x3x3
Pools: 1,7,14 / 1,6,12
View Map
Sequence
Unigene: MgU529 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 124-388 bp
TCTAGTACACGATTTGTGGTTCGAACTCGGCAAAGTCCACTGAACCAGACTCGATGGGTTT
CATGAGATAGGCAGCCAATATCTCGGAAACCAGAGCTGCAATGAGTGGGACCCGCTTCAA
GTTCTTCACCAAAGGTATATCTTCGGTCTCCCCTATGGCGAGCAGTTGCTCGTTTATTAC
CACCATCCTGTCCAATTTCCTCTTGAATTCCGGATGCTCAACATCTGGTACCGCTGGGA
ATATTCTTGCAG
TTGTTCGATTTGTC

>Exon-2 389-487 bp
CTCAATGATAACATGCATGTCGAATTCTTTAGTGTTGAGACCAATCCCCTCGTAAAAGGC
TGT
TCTTTGGCAGTCATTGAGGTACATCGTCACATAAACC

>Exon-3 488-815 bp
CGAAAGGCAGAAGAAGCGGGACCACAGCTTGGCCTTCCAGTCATTGAGGAACTGTGGCTGT
GCCTTCATCAAAGCAGAGAAGAAATCGCCGTGTCGATTCTCGTCTTGGCACCAGTTCT
CAAAGTACTTGAAAATTGGGTAGCATTGGAATTCTGGGTTTTGCTTCAGATGCCTGTATA
TAGATATGTATCTCCAATATCCGATCTTTTCGGATAAGTAAGTTGCGTAGAAGATGAACT
TAGGCTTGAAGAAGGTGTACTTTCTTGCCTTTGTTAGGAATCCCAAATCGAGAGCCAAAT
TGAAATCGGATAAACCTTTGTTCAGAAACC

>Exon-4 816-880 bp
CCTGCGTGACGGGCTTCGTCTCTGGACATGAGAGAGAAAATCTCTGCTACAATAGGGTTGG
TTTTC

>Exon-5 881-1339 bp
CTTGAGCCTCCTACCAAGCTCCTTGTAGAGAAGAAACCCAGAGAATTCAGCAGTGCAAGAC
CTCTCCAAGAACTCAACAAAAATCTGTCTCAACGGGTCCTCGAGTTTGNTCGGCGGCTTC
CTTAAACTCCTTGTTCCTAACGAAGTGTGTCTGGTTGAAATCTGTCTTGAATTCCTGCAT
CAGCGCCTCGAATTCCGCCATGTTCAGGTTCTGGTTGATCTCCGTGTTGAAGAGCTGCTC
CATTTCGTCGAAGTCGGTGGTGTAGAACCTCGGCGCCAAAAGGGTCTCCTTTATCTCCTT
CTTCGGTCCCTTCTTGTTGCTCCTCGCCGGAGCTGACGGCGGCGCCGCGGCGGACGACAT
TCTTACGGTGGCGAACCTCGTGCATGGGGCTCGGGTTGAGGTCCCGATTCTTGGGCTGAA
CTTGGAAATGGGTTTCAGGAGCGCCATTTCTGCTGCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: