MgSTS2

Genetic marker
Map(s): Not Mapped
Forward primer: GCGGCGAGTTCAGTATTTTC
Reverse primer: AATTGGGCTCCTCGAAAGTT
Tm: 0.0
Physical marker
Overgo sequence fw: AATTGGGCTCCTCGAAAGTTAGCC
                ||||||||
Overgo sequence rv:                 TCAATCGGCTTGGCACCTGTGTTA
Tm: 65.4
Set: D
Pools: 1,6,12
View Map
Sequence
Unigene: MgU803 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 230-441 bp
TTCATATTCCAAAACCGAAAACTCCGCGAATTCTGGGGAATATAAAATCTCTCCATCCCCT
CTCCGTGTTTTCCACCACTGGCGCATTCCCGTATCTGTCTTCCTCAGGTACATCAATGGG
TGTAAGCTTGACAACTGTCGTCCCGGAATTGGGCTCCTCGAAAGTTAGCCGAACCGT
GGACACAAT
GCCGTCGGGCCAGCTTCCGAATCTCC

>Exon-2 442-521 bp
CATTGCTGAACAATCAACTTCCCCTCCTGCAACTCCATGTTCTTCCCTGTCACAAAGCCCT
CGAAAATACTGAACTCGCCG

>Exon-3 522-673 bp
GC
CAACCTCCTTAACTATCTTCGCATTGCTCTGAGTGAAACCCTTCCACCGATTTTCATC
GAGCAGAATCTCGTACAGATCTTTTGCCCTACAGCTAAACTTCTCCGTCATTGTTATAGG
CTTGAACCCTTCCTTTTTCTTCTCTTTCTTCTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: