MgSTS19

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 39.90cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 26.78cM

Forward primer: ATTTGCCGTTCCACAATCTC
Reverse primer: AGTTCCATTCGACCGATACG
Tm: 0.0
Physical marker
Overgo sequence fw: CGCCACACTCAATAACCTCCCACT
                ||||||||
Overgo sequence rv:                 GAGGGTGAGCAAAGAAGTGCATAG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC161
MG__Bb075E06
MG__Bb089B09
MlFPC147
ML__Ba029B16
MlFPC55
ML__Ba008L17
ML__Ba078N10
ML__Ba060F22
ML__Ba087B21
ML__Ba011C12
Set: A
Pools: 1,7,13
View Map
Sequence
Unigene: MgU140 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 299-436 bp
CTGTAATAATGTTCATAAACTTCCTTTTCGCAAATGCCAACCACCATTTGTTTGGAGTTC
CATTCGACCGATACG
CCACACTCAATAACCTCCCACTCGTTTCTTCACGTATCTGCT
TCAAATAATTTCTGAACAGCTC

>Exon-2 437-706 bp
CTGCCTCTTGTTGAGATTGTGGAACGGCAAATAAACCTGGAAACGGGAAACCGTGTTCT
CCAGGCACAGGGACCTTTTCCAACCCGAGATTTATAATTGCTTTCGTTCCTTCAGCCAAT
GTTCTGCAGCCTTCTAATCTTTTCAGAGCAATATTTATATAGAATGTAAGGTATATAAGA
AGCTTATCAGCTGAACTTTTGACATCGAAGTTTCTAAAAAATACGTTGGCACGAAAAAAC
GTAATTGCTTCATCGACAATATCAGCAATATC

>Exon-3 707-817 bp
CTTGTTCTGAAACTGGAGCTGGTCCTTTTATGTGGCTTTTTAAGGGAAGTAGAGGGCAACC
ACATGCCTTAGTAATTTCTTCATCGTCGACGAAACTTGAGTGGTAGACCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: