MgSTS18

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 91.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 80.52cM

Forward primer: GGTTGGCCAAGTATCGATTT
Reverse primer: AGGCAAACCCACATAGCATC
Tm: 0.0
Physical marker
Overgo sequence fw: AAAAGAGCGCCGAAGCTGGCTCCA
                ||||||||
Overgo sequence rv:                 ACCGAGGTAAGGTTCGAAGATGTT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC470
MG__Ba025A04
MG__Bb023F17
MG__Ba016J22
MG__Bb020L19
MG__Bb084P05
MG__Bb074C24
MG__Bb025B16
MG__Ba085G17
MG__Bb092O04
MG__Bb096M14
MG__Ba024J24
MG__Bb079C18
MgFPC836
MG__Ba055O06
MlFPC1192
ML__Ba084E13
ML__Ba010J11
ML__Ba004D15
ML__Ba091C15
ML__Ba082H22
ML__Ba091K06
ML__Ba045E12
ML__Ba093L01
MlFPC1618
ML__Ba042O04
Set: A
Pools: 1,7,12
View Map
Sequence
Unigene: MgU772 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 114-245 bp
ATGTACAGTGGTTCCAGTGACGGCGAGGCGTCGGCGCAGAGGAGAATTCCGGCGGCGTCTT
CCATGCTCTGGGTTCGCAATCTCCGCCGCTTCATCGGATCCGGTGCCGGCCTCGGATCCG
AAGCCCTCACCG

>Exon-2 246-337 bp
GAACTGGAGACCAAACGCATTTTGCTCGATATTTTTAAGGAGAAGCAACAAAAGAGCGCC
GAAGCTGGCTCCATTCCAAGCTTCTACAA
GAAG

>Exon-3 338-400 bp
GAAACCTGAAGAAGGTTCCATTAGTCATAGAGTTCAAAGGTTGGCCAAGTATCGATTTC
TCAAG

>Exon-4 401-499 bp
GAAACAATCAGATCTTCTGTTGAATGCCGATGACCTGGATGCTATGTGGGTTTGCCTGA
GGGAAAATTGTGTAATTGATGATGCAACTGGTGCTGAAAAG

>Exon-5 500-658 bp
GATGAATTATGAAGACTTCTGCCACATTGCCTCAGTATGTACAGAACAAATAGGCCTCAAT
GGTCGACGTTTTTTCAGTCCCTCANATTTCATGAAGTTTGAGAAAGATGAATCCGGAAGA
ATTTCCATCCTGCCTTTCTATCTATATGTGATGCGGACG

>Exon-6 659-690 bp
GGTTTCACTTACTCAAGCGAGAATTGATATGAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: