MgSTS17

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 113.40cM
M. guttatus Irn Mtn Combined(2009)14 48.66cM
M. guttatus IM62_x_DUN RILs(2009)14 106.62cM

Forward primer: GAGGCATGCAAAAGACACTG
Reverse primer: GTTTGAAGACCTGGCTTTGC
Tm: 0.0
Physical marker
Overgo sequence fw: GCTCCATGCGTGATGCAATACTCA
                ||||||||
Overgo sequence rv:                 TTATGAGTCGAACACTAGGCAAAC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2591
MG__Bb076N05
MG__Bb058J01
MG__Bb095F21
MG__Bb093K03
MG__Bb090B05
MG__Bb040F19
MG__Bb034I07
MG__Bb084B03
MG__Bb090L07
MgFPC694
MG__Bb004M11
Set: A
Pools: 1,7,11
View Map
Sequence
Unigene: MgU1140 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 186-304 bp
AGTTGCGTTTTGAAGACGGAAGCAAGCAGTCATAGACCCGCTCCATGCGTGATGCAATAC
TCAGCTTGTGATCCGTTTG
AAGACCTGGCTTTGCCAAATCAATAATATCCTGTCTCA
AAC

>Exon-2 305-405 bp
CATATCCATTCACCAGTGTCTTTTGCATGCCTCTCCACCAGACAGTGTAGGGAATTAAG
AAAACACAACCCTAGTCCGTACATGCATTGAGCATCGTTTTCC

>Exon-3 406-516 bp
CAATCCTTGATCTTTGTAAATCTGAAACTGCATTATAGCTCTCTCAATTTCTCTCAGCAGT
AGCCTTCTTTGAATACGAGCAACTCTTCCTCTACCTTCAGCTCTGGTATCC

>Exon-4 517-640 bp
CTGTTTAAACCATGCTCGCACCACCATGACTAGAATGAGGGAGATAAAGAAAGCTGGCAAA
GCAGCTAGAATAGCAAAGTTGATTTCGTTGGCCCTCACGATCTGATCTAGCTCAAGCATT
GCTT

>Exon-5 641-669 bp
TCTTCAATATCCAGTTGTAGCTTCTGAACC

>Exon-6 670-716 bp
CTGAATAAGAAGAGCACGTACAAGCTCTCCACCAACAAGACCATGAAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: