MgSTS16

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 7.34cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 10.11cM

Forward primer: CTGCAATCGAGGGATTTGAT
Reverse primer: GCTCGGTCGATTCAGTCTTC
Tm: 0.0
Physical marker
Overgo sequence fw: ATGTGCTACAGTCTGCAATCGAGG
                ||||||||
Overgo sequence rv:                 TTAGCTCCCTAAACTAGCGGCTGT
Tm: 65.4
Set: A / 3x3x3
Pools: 1,6,15 / 1,6,11
View Map
Sequence
Unigene: MgU609 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 2-309 bp
TACGGCGTGGGCCTGTCGGATGACGACATGCACAAACCCCAGGTGGGGATTTCTTCGGTCT
GGTACGAGGGCAACACCTGCAACATGCATTTGCTGAAGCTCGCCGAGGCGGTGAAGGAAG
GCGTCGAGAACGCCGGGATGGTCGGGTTCAGGTTCAACACCATCGGCGTGAGCGACGCCA
TTTCAATGGGGACCAGAGGCATGTGCTACAGTCTGCAATCGAGGGATTTGATCGCCG
ACA
GCATCGAGACCGTCATGGCTGCTCAGTGGTACGACGGCAACATCTCCATCCCCGGC
TGCGACAAGAAC

>Exon-2 310-381 bp
CATGCCAGGTACTATTATGGCTATGGGAAGACTGAATCGACCGAGCATTATGGTCTACG
GTGGAACAATTAAG

>Exon-3 382-429 bp
GCCAGGTCATTTTCAAGGTCACACATATGATATAGTATCCGCTTTCCAG

>Exon-4 430-584 bp
GGTTTATGGAGAGTACGTGAATGGTACTGTAAGCGACGAAAAAAGGATGGCAGTAGTTCGT
AATTCTTGCCCTGGAGCAGGGGCGTGTGGTGGAATGTACACCGCANACACAATGGCCTCA
GCTATTGAAACAATGGGCATGTCTCTTCCTTACAG

>Exon-5 585-695 bp
GTTCTTCGACCCCAGCAGAAGACCCTCTGAAATTAGATGAATGCCGCCTCGCTGGCAAATA
TTTGCTAGAGTTGCTTAAACTCGATTTGAAGCCTCGTGACATCATCACCCC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: