MgSTS15

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 51.99cM
M. guttatus IM62_x_DUN RILs(2009)11 35.69cM

Forward primer: CCGTGTGGATTTGAAGGAGT
Reverse primer: CGCCGTCTTTCAAGAATCTC
Tm: 0.0
Physical marker
Overgo sequence fw: GGTCCAAGCCACCTGTTGATGAAG
                ||||||||
Overgo sequence rv:                 ACTACTTCGGGATCTATAGAGAAG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2204
MG__Bb094E20
MG__Bb031F08
MG__Bb016D16
MgFPC455
MG__Bb065F22
MgFPC468
MG__Bb022B03
MG__Ba039I08
MG__Ba085F02
MG__Bb053I10
MG__Bb095I09
MG__Bb096L24
MgFPC823
MG__Ba023O21
MlFPC1246
ML__Ba060L15
MlFPC1436
ML__Ba066C07
MlFPC448
ML__Ba047B01
ML__Ba004H03
ML__Ba078E12
ML__Ba046K02
ML__Ba028C04
ML__Ba058G05
ML__Ba046J22
MlFPC933
ML__Ba066M03
Set: D
Pools: 1,8,13
View Map
Sequence
Unigene: MgU485 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 182-320 bp
ACTACTTACCCCTCCATTTCCACCACCATATCCGCACGCTACGGCGGCGGCGGCGGAGGAG
GAGGCGGCGGCGGAGGCGGCGGCTACTCGAAGCGGTCCAAGCCACCTGTTGATGAAGCC
CTAGATATCTCTTC
AATTAA

>Exon-2 321-360 bp
AGTCTGATACTGTTAGGCTTATTGATGAAGAGCAGAAGATG

>Exon-3 361-420 bp
GGTTGGATTAGTATCGAAAGCTCAGGCTTTTCAAATGGCTGAGGATGCTGAGCTTGACTTG


>Exon-4 421-473 bp
GGTGATATTATCTCCAGATGCAGATCCTCCAGTTCTAAGAATTATGGATTACAA

>Exon-5 474-523 bp
ATAAATATAAATACGAGCAGCAGAGGAAGAAAAAAGAACAACAGAAGAAAA

>Exon-6 524-563 bp
AGTCTTGCTACCCGTGTGGATTTGAAGGAGTTGAAGATGGG

>Exon-7 564-636 bp
GTTATAATATCGATGTCCACGACTACTCCGTGCGTTTGAGAGCAGCTCAGAGATTCTTGA
AAGACGGCG
ATAAG

>Exon-8 637-729 bp
GGTCAAGGTTATAGTAAGTCTGAAGGGCCGTGAAAATGAATTTAGAAATAATGCCATCGAG
CTtctCAGACGATTTCAGAACGATGTTGGGGAG

>Exon-9 730-869 bp
GCTGGCAACAGAGGAAGCTAAAAGTTTCCGGGACAGAAACATGTTCATTGTAATGATACCA
AACAAGGCTATTACACAGAAAGCACAAGAACCTCCGAAGAAAAAGGACACTCCCGTAGAA
AACGAAGTTTCAGCCAGTGT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: