MgSTS13

Genetic marker
Map(s): Not Mapped
Forward primer: AAATCCAGGCGAGGAGAAAT
Reverse primer: AATCCGCAAAGTTCGAGAAA
Tm: 0.0
Physical marker
Overgo sequence fw: AAGCGCAGGAGCACGCGGAGTTAA
                ||||||||
Overgo sequence rv:                 CCTCAATTGGTTTGTGTGGTTAAA
Tm: 65.4
Set: D
Pools: 1,8,11
View Map
Sequence
Unigene: MgU460 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 2-138 bp
TGCGGAACGCTGTTGAAGTCGGTGGAGGAAGCGCAGGAGCACGCGGAGTTAACCAAACAC
ACCAATTT
CGCCGAGTCCACCGAGCCCGTGCTTAATCTAGTCTGCTCCGACTGCAGCAA
GCCTTGCCGCTCGAAAACC

>Exon-2 139-289 bp
CGAGAGAGATCTGCACACTAAGAGGACAGGGCACACTGAATTTGTGGACAAGACTTCAGAG
GTAACAAAGCCAATAAGTTTGGAGGCTCCAAAGCTTAAGGATGATGTGGATATGGAAGAA
GCAGGCGATGGCAGTACTAGTCAACAAGAAG

>Exon-3 290-385 bp
GAAATGGTAGTTCCTGAAGTCAATCAGCAGCTATTCTCAGAGCTTGAGGAAATGGGATTTC
CTAAAGAAAGGGCAACTCGTGCACTTCATTACTCTG

>Exon-4 386-462 bp
GGCAATAGTAGCCTTGAGGCTGCTGCAAATTGGATAGTCGAACATGAGAATGACCCGGATA
TCGATCAAATGCCACTG

>Exon-5 463-542 bp
GGTACCTGTCAATTCGAAAAAACCTGTTCCAAAGCCATCCCTCACACCGGAAGAGATTAAG
CAGAAACAACAAGAATTAAG

>Exon-6 543-603 bp
GGGAACGGGCTCGcanaAAGAAGGAAGAGGAAGAAAAACGAATGGAAAGAGAAAGAGAGAA
G

>Exon-7 604-671 bp
GGAAAGAATTAGAGTGGGGAGAGAGCTGCTTGAAGCanaacGCATTGAAGAAGATAATGAA
AgaaaaCG

>Exon-8 672-753 bp
GTATACTTGCACTGCgGAAAGCAGAGAAACAGGAAGAACAAAGAGCTAGGGAGAAAATTCG
TCAAAAGTTggAggaAgATAAg

>Exon-9 754-837 bp
ggcagAGAGAcGTAGAAAACTTGGGTTGGCCCCAGAAGATCCAGCTGTTGTAAAGCcttCT
GCTCCACcGGTggAGGAAAAAAAG

>Exon-10 838-915 bp
GAGCTTCTTGCCTATCCGCCCAGCTACAAAGGCAGAGCAGATGAGAGAGTGCTTAAGAACC
CTTAAACAAACTCACAAG

>Exon-11 916-1035 bp
GGAGGATGATGCAAAAGTGAAGACCGCTTTCAACACACTTTTAACTTTCGCAAAAAATGTT
GCAACAAATCCAGGCGAGGAGAAATTCCGCAAAATTAGACTCACCAATGCTACTTTTC
AG

>Exon-12 1036-1212 bp
GGATCGAGTTGGAAAACTGAAAGGAGGCATTGAATTTCTCGAACTTTGCGGATTTGAGA
AAATCGAAGGGGGCGAATTCTTGTATCTACCACGAGAGAAAGTTGACATCCCGGTGCNTT
CACTCTGCAGGAAGCGAGTTAAACAGTGCCATCAATAATCCTTTCTTCGGAGTTCTTTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: