MgSTS12

Genetic marker
Map(s): Not Mapped
Forward primer: CGCTTTGACACCCTTGATTC
Reverse primer: GCCTCCTCATGAACTCCAGTA
Tm: 0.0
Physical marker
Overgo sequence fw: CCTCCTTCTGAAAGGACCTTTGCT
                ||||||||
Overgo sequence rv:                 GGAAACGACTTACGGGTTAGTTGC
Tm: 65.4
Set: D
Pools: 1,7,15
View Map
Sequence
Unigene: MgU382 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 271-308 bp
ATCAGaATCTCCTCCTTGGACTCCTCGAACGATGACCAC

>Exon-2 309-463 bp
CGAGGCGATCTTCTCCGGATGTTCCTCCTTCTGAAAGGACCTTTGCTGAATGCCCAATCA
ACG
TTTATGATGTGAGTGAGCAGATCAGTTCCATCCATTTCACTTATAGCTCTCTGTGC
CTCATCAAACTTCTCGTATTCAATTAGAGCATACCCC

>Exon-3 464-600 bp
CTTGACGAAACCCGTACGGCGGTCGAGATTCAAATGTAAATTCTTTATCTCTCCAAATTCA
CCAAATGAATTCTGTAGATCGTCTTCTTGCGCCTCCTCATGAACTCCAGTAACTAGAA
CAATCCATCCTTCAATGGA

>Exon-4 601-873 bp
ATCGTTCGGTTCCAGGGCCACCTTCAGAATCAAGGGTGTCAAAGCGGGCGGACATACGA
GCATTGCGGTCTGCTTCAGCAGCAGCCTCGTCGCGGAATCCGCGTCCCTTGGTCTTCTTC
GGGGCCGAGGAGGAGCCGCCGCCGGCGATGGCGGACTTCAGGCGAGGGGTAGTGGTGGGG
GCGGTTCGGTTTGGGGAGCCATCGGCAACTTCGTCGTCCATGAGATCATCTTCCTCTGGC
TCGAAATCGACGGCCTCAGCTTCCACGTTCGCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: