MgSTS11

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 31.10cM
M. guttatus Irn Mtn Combined(2009)13 95.99cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 2.19cM

Forward primer: GCTCCAGATTTTCACCAAGC
Reverse primer: ACATCCACCCTTCTGGTACG
Tm: 0.0
Physical marker
Overgo sequence fw: GGAACTTTGCTCCAGATTTTCACC
                ||||||||
Overgo sequence rv:                 AAAAGTGGTTCGGGCAGCCACTAT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2723
MG__Ba021P16
MG__Ba084I19
MG__Ba001I14
MG__Ba084O20
MG__Ba024D17
MlFPC1619
ML__Ba013L15
MlFPC21
ML__Ba024C18
MlFPC729
ML__Ba068I22
MlFPC81
ML__Ba038F14
ML__Ba086C20
ML__Ba054L13
ML__Ba050L06
Set: A
Pools: 1,6,14
View Map
Sequence
Unigene: MgU340 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-193 bp
agAAAGAGGAGTTGCATTGGAGGGTTCGATTTTATGCCCTCACCTCCGCCTACTTATTACA
GGAACTTGAAGAGCAGGGCTGGAGATGTTTTGAGTGACGAACAGATCCAAGAGTGCGAGG
AATTGGGGATCTTGGTCGATCGAGACGATCAAGGAACTTTGCTCCAGATTTTCACCAA
GC
CCGTCGGTGATA
G

>Exon-2 194-352 bp
GGCCGACTATATTCATAGAGATAATTCAGCGTGTAGGTTGTATGCTGAAAGACGAGGAGGG
AAAGACGTACCAGAAGGGTGGATGTGGAGGATTCGGAAAGGGGAATTTCTCCGAACTC
TTTAAATCTATCGAAGAATATGAAAAAACACTCGAATCTGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: