MgSTS100

Genetic marker
Map(s): Not Mapped
Forward primer: CGAGCTCACCAGAACTCCTT
Reverse primer: AAATCGTAGCGGCTGAGAGA
Tm: 0.0
Physical marker
Overgo sequence fw: CCGGCACTTGAGCTCCGACATTGA
                ||||||||
Overgo sequence rv:                 CTGTAACTCTATCAATTGTAGCTG
Tm: 65.4
Set: D
Pools: 3,6,12
View Map
Sequence
Unigene: MgU175 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 149-232 bp
CTCAGCAAATGAATATCTTGAATTCCGGCACTTGAGCTCCGACATTGAGATAGTTAACAT
CGAC
AACAACTTCCCCAAAATCCTC

>Exon-2 233-325 bp
CTTCGTACAATGTCCTCGCAATACGAACATAGTCGTGTACAAGATCTCGGTAAACTATCCC
ACCGGGACTCGCATCCAATGCGACCAGGACACC

>Exon-3 326-424 bp
CTGGCGCCAGCCAACATGAATCCGAAGAATTGCACGGCAGTGGAGCAAGCCATAATATATT
CCTCAAATTCATCGAATTGTCGTAAGAAACATTCGATCC

>Exon-4 425-491 bp
CCGTTTGGCAATAGCCCATATAGACGGGGAATTTTTGCTTATCGTAAGCGGGGTATTCTTT
AGCATGA

>Exon-5 492-495 bp
AAACA

>Exon-6 496-638 bp
AAAATGCCTAATCTACCGGATTCGTTTGCAATGAATAGGTGGCCGTGGAATAAATCGTAG
CGGCTGAGAGA
TACATTGAGCCCTAATTCCGGACCGCGCTCGACAATTACGTCGAATAA
GAATTTGAGGTAGGAATTCAAACCC

>Exon-7 639-716 bp
CTCGTCTATGAATTGCCACCCGTAAGGAGTTCTGGTGAGCTCGCACCGGGATTGATTTG
ATCCTTCGACGTCCGGAACG

>Exon-8 717-1052 bp
GGTGATCGGAGTCGGATCTAGGGCTCGGTGGATGGCGCCGGGATCGCCGCCGGATTCTACG
GCGAGGCGGGCGAGCTCCAGTACGGGCGCCGGAGGCGACGTTATCAGCTCGTCGATTTCG
TTGCTGCTCCGATTTGACGGTAAGACGATGCTAGAACTCAGCATTTGCCTTGCGGCGGTG
GGCGGTGGGTTGTAAGGAGATAAGAATTTGAAGCATGAGCGTAGATCACGCGCCACCTGT
GCGTTGACTGAGCTGGCCTGTTGTGGCGGGCCNGAGGAGGGAGAGCAGGTCCGAGACTGT
GGCTTTGGGCCTTGTTGATGGAGAGGGGGAATAAGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: