MgSTS10

Genetic marker
Map(s): Not Mapped
Forward primer: TGCCCATGACGAAATACAAG
Reverse primer: CTGCCCCATAGTCTGCTTCA
Tm: 0.0
Physical marker
Overgo sequence fw: TTAGAGCGTTGTTACTGCCTAGCT
                ||||||||
Overgo sequence rv:                 CGGATCGACAAAAGGCTCCCGCAA
Tm: 65.4
Set: D
Pools: 1,7,14
View Map
Sequence
Unigene: MgU261 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 83-333 bp
ATCACTTCCACAATTCTTCCATGGGAATGCCGCGTTCTTCGGCCACTTCACGAAACTGTCT
CATCTTCTGTACAGCAACAACTGTGGCTCTTGCGTTGTTTAGAGCGTTGTTACTGCCTA
GCTGTTTTCCGAGGGCGTT
CTCGACTCCGGCGAGTTCTAGAACTATCCGGACTGACCCT
CCGGCGATGACACCTGTACCTGGTGAAGCTGGTCGAAGCATCACTCTTGCTGCCCCATA
GTCTGCTTCA
GATC

>Exon-2 334-811 bp
CTGTGAGGAAACGTCTTGTATTTCGTCATGGGCACGCTGACGATGTTCCGTCTAGCATT
AAGGGCCGATTTCTGGACAGCGGAAACCACCTCCTTGGCCTTTCCGACACCGACGCCGAC
ATTGCCTTGTTTATCGCCGACGACAACAATAGCACGGAAGTGCATTTGCTTCCCTCCCTT
CACAACCTTCGTAACCCTCCTCACCTGAACCACCCGTTCATCAAACCCATCTCTGACTTT
CTCTTTCTTAGTTTTTGACCCGAACCCGGTTGCCTTCTTCACCTTAGCGTCCATTACGTA
CACATCGTTGCCGAGGAGAGTCTCGCCGCTGTACGCGGGGCCGTAGATTTCTTCGTAGGC
TCTCGCGATGTCCTCCTCCGACTCCATTGGTCCGTCGTCGAACGACGGCGGCGCGATGAA
GTCCTCCGGGCGCTCCGGCGGGCTGAATGTGGAGACTCCCTCCGGGTCATCGTCGGGGTA




**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: