MgSTS1

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 84.66cM

Forward primer: AATGGAAGTTGCCGAAATTG
Reverse primer: AATGCCAAGTGAGCTGCTTT
Tm: 0.0
Physical marker
Overgo sequence fw: ACGACTTCAAATTCCAGCCCATCA
                ||||||||
Overgo sequence rv:                 CGGGTAGTTCCTTAGGTAGCAGCG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC726
MG__Ba088M03
MlFPC377
ML__Ba042L14
MlFPC711
ML__Ba086J06
ML__Ba093K22
ML__Ba096K03
ML__Ba039K22
ML__Ba049I24
ML__Ba091E15
ML__Ba088C24
ML__Ba014E17
ML__Ba028A05
ML__Ba075A19
Set: D2
Pools: 5,10,15
View Map
Sequence
Unigene: MgU537 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 90-496 bp
ATGGCAGCCATGGCTACAACCCTCAGATCCTCCCTCACCAAGACCTCCTTCTTCGACAACA
AGTCCACCTTCCACGGCGCCGCCGTCGTGCCCACACGCGCCGCCCAGCCCATCAAATCCA
CCCCCAAGAACCTCGCCGTCGCCATGGCCTCCACCCCCTACAACCTCGACGACTTCAAA
TTCCAGCCCATCAAGGAATCCATCGTCGC
GCGTGAGATGACGCGCCGCTACATGACGGA
CATGATAACCTACGCCGACACCGACGTGGTCGTCGTCGGCGCCGGATCCGCCGGCCTCTC
CTGCGCCTACGAGCTCAGCAAGAACCCCGACATCAACATCGCCATCATCGAGCAGTCCGT
CAGCCCCGGCGGCGGCGCGTGGCTCGGCGGCCAGCTCTTCTCCGCCATG

>Exon-2 497-985 bp
GGTGGTCCGCAAGCCGGCCCACAAGTTCCTCGACGAGCTCGAGATCGAGTACGACGAGCAG
GACCACTACGTGGTGATCAAGCACGCCGCCCTCTTCACCTCCACCATCATGAGCAAGCTC
CTCGCCCGCCCCAACGTCAAGCTCTTCAACGCCGTCGCCGCCGAGGATCTCATCGTCAAG
GGCGGCCGAGTCGCCGGCGTCGTCACCAACTGGGCCCTCGTCGCCCAGAACCACCACACC
CAGTCGTGCATGGACCCCAACGTCATGGAGGCCAAGATCGTCGTCAGCTCGTGCGGCCAC
GACGGCCCCTTCGGCGCCACCGGCGTCAAGCGCCTTAGGAGCATCGGAATGATCGAGAGC
GTCCCCGGGATGAAGGCCCTCGACATGAACACCGCCGAGGATGCCATCGTCAGGCTCACC
CGAGAGATCGTCCCCGGCATGATCGTCACCGGAATGGAAGTTGCCGAAATTGACGGCT
CTCCAAGAATG

>Exon-3 986-1144 bp
GGGGNCCCACATTTGGAGCGATGATGATTTCGGGACAGAAAGCAGCTCACTTGGCATTG
AAGGCTTTGGGATTACCACATGCTTTGGATGGTTCTTACAGTGAAGCTCAACCGGAGCTT
GTTTTGGCTTCGGCCGAGGCCGATGATGTTGTCGAGGCCTA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: